Human Genetics with Mustard

Doug Wendell and Dawn Pickard, co-PIs
Oakland University, Rochester, Michigan

The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers. Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.

As we develop DNA markers and lab procedures we will post the here for all to try.

The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type). We will be posting protocols and data on the markers as we develop them. The intention is that this be interactive so we encourage users to post comments. Did the materials work? What steps did your students have problems with? What parts do you like? Do you have suggestions for improvement?

Please also check out our YouTube channel: http://www.youtube.com/user/HumanGeneticsMustard


Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)

Thursday, November 17, 2011

More reliable DNA purification using spin columns

PROCEDURE:  DNA Purification from Plant Tissue Using a Spin Column
Protocol based Qiagen DNeasy Plant DNA purification kit instructions with minor modification

Important notes before starting
  • Whenever you obtain some solution from a bottle, use a clean unused pipettor tip.
  • If you are purifying more than one sample, be careful not to mix up or cross contaminate them.
  • In some steps* of the procedure, you are instructed specific volume and you will see that some liquid is left behind.  This is done because the following step requires a precise volume of sample.  Although this results in a reduced yield of DNA, there will still be plenty of DNA to do all of the tests you need to do.
Procedure:
  1. For each tissue sample, obtain the following and label them with the plant’s ID number, printed clearly with an extra fine point Sharpie:
    • three 1.5 ml microcentrifuge tubes (label top and side)
    • one DNeasy spin column and collection tube (label both parts)
  1. Obtain a piece of fresh or frozen leaf tissue of about 50 milligrams.  If a balance is not available, use a leaf or piece of leaf at least one and no more than two square centimeters.
  1. Place the leaf tissue in a mortar and pestle.  Add 700 µl of Buffer AP1 and 7 µl RNase A stock and carefully grind the tissue until all is liquefied.
  2. Collect 500 µl* of the homogenate and place it in a 1.5 ml microcentrifuge tube labeled with the plant’s ID number.  (If you can’t collect 500 µl, add more Buffer AP1 to bring the volume up to the 500 µl mark on the tube.)  Close the tube and incubate in a 65° C water bath for 10 min.  All of these procedures break down tissue and cell structure and solubilize the molecular components of the cell.
  3. Add 165 µl of Buffer AP2 to the lysate and mix.  Place the tube into ice and incubate for 5 min. on ice.  The addition of Buffer AP2 and low temperature cause proteins to precipitate.
  4. Centrifuge the lysate for 5 min. at 20,000 x g.  (It’s OK if the centrifuge is at room temp.)  Centrifugation causes the precipitated proteins to form a pellet at the bottom of the tube.  The DNA will remain in solution.
  5. Collect 500 µl* of the supernatant and pipette it into a new microcentrifuge tube.  Add 750 µl of Buffer AP3/E.  Close the cap on the tube and invert four times to mix.
  6. The next step is to pass the solution through the DNeasy spin column, but the volume of the solution from step 8 is too large to run through at once, so you will pass it through the column it in two parts.  Pipette 650 µl of the mixture from step 8 into the top chamber of a DNeasy spin column (no color) which is seated in the top of a 2 ml collection tube.  Centrifuge for 1 min. at 6,000 x g.  Discard the flow through and add the remainder of the mixture from step 8 the top chamber of the same DNeasy spin column which is seated in the top of a 2 ml collection tube.  Centrifuge for 1 min. at 6,000 x g.  Discard the flow through (but save the collection tube) and save the DNeasy spin column.  As the solution passes through the spin column, the DNA binds to the matrix in the column. 
  7. Add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g.  Discard the flow through but save the collection tube.  In the presence of Buffer AW, the DNA remains bound to the spin column, but other materials are washed away.
  8. Again, add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g.  Discard the flow through but save the collection tube.  Centrifuge the column and collection tube again for 2 min at 20,000 x g.  This extra spin removes all of the Buffer AW from the spin column so that it won’t interfere with the next step.
  9. Remove the DNeasy spin column from its original collection tube and place it in a 1.5 ml microcentrifuge tube that has been labeled on the cap and side with the plant ID number. (The cap of the 1.5 ml microcentrifuge tube will remain flipped open.)  Pipette 50 µl of Buffer AE directly onto the top of the DNeasy membrane.  Look down in to the column to make sure that the buffer lands on and is absorbed by the column, and is not simply clinging to the inside of the tube.  Allow this to stand at room temperature for 5 min.  Buffer AE causes the DNA to elute from the column. The 5 minute wait allows time for the DNA to diffuse off of the column material and into the liquid.
  10.  Load the combination of DNeasy spin column and microcentrifuge tube into the rotor of the microcentrifuge with the microcentrifuge tubes’ caps pointing in the counterclockwise direction, and leaving 2 spaces between each tube in the rotor.  (This is done to prevent the microcentrifuge tubes’ caps from breaking off.)  Centrifuge for 1 min. at 6,000 x g.    Save the flow through.  It contains the DNA.    The centrifugation draws the eluate containing the DNA out of the bottom of the spin column.
Discard the DNeasy spin column.  Store the DNA solution in the 1.5 ml microcentrifuge tube in the refrigerator until it is needed.

Tuesday, June 21, 2011

DNA Markers

Information on DNA Markers

Working stock solution
10 µM primer in 5 mM Tris, pH 7.5


D1BrapaS1
Chromosome: 1

Primer Sequences
D1BrapaS1 F  ACGCTGTGATTTGTTGCTTCCGA
D1BrapaS1 R GGAGGAGCAAGCAGGACCAGGA

Size Range: 500 – 600 bp
Example Gel:



D9BrapaS1
Chromosome: 9

Primer Sequences
D9BrapaS1 F  CCAGCCAAATCGTCACTCATGCGA
D9BrapaS1 R TGCATGCCTAAGAGTTTGGAGTAACAC

Size Range: 400 – 600 bp

Example Gel:






D9BrapaS4
Chromosome: 9

Primer Sequences
D9BrapaS4 F  AGCGATGTAGCACCCGAGTCCA
D9BrapaS4 R TCGAGCTGAGAGGGAAGCTGTGA

Size Range: 300 – 600 bp

Example Gel:

Thursday, June 9, 2011

PCR Protocol for RBr DNA Markers

PCR Reactions with PCR Premix
The following is the procedure for starting PCR reactions for the four individuals in your paternity case and one negative control reaction.  The negative control is a reaction with every ingredient except primers.  This procedure uses a liquid premix that contains Taq DNA polymerase, buffer, magnesium chloride, and the nucleotides dATP, dCTP, dGTP, and dTTP.
We have tried several brands of Taq Polymerase and find that Taq from Syzygy Biotech (www.syzygybiotech.com) give excellent results and is very cost effective.

Part I.  deciding how many microliters of DNA sample to use
In each PCR reaction, you should use 40 nanograms of DNA.  For each sample, calculate how many microliters (rounded to the nearest microliter) that you need to obtain 40 ng.
Consult the instructor if the amount needed is more than 4 µl or less than 1µl.

Part II-A.  setting up a single reaction
1.      Use a fine point Sharpie to label a 200 µl PCR tube with the ID # of the plant.
2.      To this tube add the following.:
            12.5  µl Syzygy Taq 2X Master Mix
              2.5  µl Forward Primer stock
              2.5  µl Reverse Primer stock
                x   µl DNA
           7.5–x µl milliQ water*
                  *The  7.5-x ul of water is added to make the total volume of all reactions equal to 25 µl.
3.      Set a micropipettor on 20 ul and with a new clean tip, gently pipette back and forth twice to mix the reaction components.
4.      Follow your instructor’s direction to load them in the thermal cycler.

Part II-B.  negative control
For each group, prepare one negative control as follows:
            12.5  µl Syzygy Taq 2X Master Mix
              8.5  µl milliQ water
              1.0  µl Mother DNA
              1.0  µl Child  DNA
              1.0  µl Possible Father #1 DNA
              1.0  µl Possible Father #2 DNA
Close the cap on the tube and flick with your finger until the bead is dissolved.  Centrifuge a few seconds to send all of the liquid to the bottom of the tube.  Follow your instructor’s direction to load them in the thermal cycler.

PCR Cycles
94 degrees, 2 minutes
25 cycles of
      94 degrees, 30 seconds
      61 degrees, 1 minute
      72 degrees, 1 minute
72 degrees, 4 minutes
end