Human Genetics with Mustard

Doug Wendell and Dawn Pickard, co-PIs
Oakland University, Rochester, Michigan

The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers. Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.

As we develop DNA markers and lab procedures we will post the here for all to try.

The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type). We will be posting protocols and data on the markers as we develop them. The intention is that this be interactive so we encourage users to post comments. Did the materials work? What steps did your students have problems with? What parts do you like? Do you have suggestions for improvement?

Please also check out our YouTube channel: http://www.youtube.com/user/HumanGeneticsMustard


Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)

Tuesday, June 21, 2011

DNA Markers

Information on DNA Markers

Working stock solution
10 µM primer in 5 mM Tris, pH 7.5


D1BrapaS1
Chromosome: 1

Primer Sequences
D1BrapaS1 F  ACGCTGTGATTTGTTGCTTCCGA
D1BrapaS1 R GGAGGAGCAAGCAGGACCAGGA

Size Range: 500 – 600 bp
Example Gel:



D9BrapaS1
Chromosome: 9

Primer Sequences
D9BrapaS1 F  CCAGCCAAATCGTCACTCATGCGA
D9BrapaS1 R TGCATGCCTAAGAGTTTGGAGTAACAC

Size Range: 400 – 600 bp

Example Gel:






D9BrapaS4
Chromosome: 9

Primer Sequences
D9BrapaS4 F  AGCGATGTAGCACCCGAGTCCA
D9BrapaS4 R TCGAGCTGAGAGGGAAGCTGTGA

Size Range: 300 – 600 bp

Example Gel:

Thursday, June 9, 2011

PCR Protocol for RBr DNA Markers

PCR Reactions with PCR Premix
The following is the procedure for starting PCR reactions for the four individuals in your paternity case and one negative control reaction.  The negative control is a reaction with every ingredient except primers.  This procedure uses a liquid premix that contains Taq DNA polymerase, buffer, magnesium chloride, and the nucleotides dATP, dCTP, dGTP, and dTTP.
We have tried several brands of Taq Polymerase and find that Taq from Syzygy Biotech (www.syzygybiotech.com) give excellent results and is very cost effective.

Part I.  deciding how many microliters of DNA sample to use
In each PCR reaction, you should use 40 nanograms of DNA.  For each sample, calculate how many microliters (rounded to the nearest microliter) that you need to obtain 40 ng.
Consult the instructor if the amount needed is more than 4 µl or less than 1µl.

Part II-A.  setting up a single reaction
1.      Use a fine point Sharpie to label a 200 µl PCR tube with the ID # of the plant.
2.      To this tube add the following.:
            12.5  µl Syzygy Taq 2X Master Mix
              2.5  µl Forward Primer stock
              2.5  µl Reverse Primer stock
                x   µl DNA
           7.5–x µl milliQ water*
                  *The  7.5-x ul of water is added to make the total volume of all reactions equal to 25 µl.
3.      Set a micropipettor on 20 ul and with a new clean tip, gently pipette back and forth twice to mix the reaction components.
4.      Follow your instructor’s direction to load them in the thermal cycler.

Part II-B.  negative control
For each group, prepare one negative control as follows:
            12.5  µl Syzygy Taq 2X Master Mix
              8.5  µl milliQ water
              1.0  µl Mother DNA
              1.0  µl Child  DNA
              1.0  µl Possible Father #1 DNA
              1.0  µl Possible Father #2 DNA
Close the cap on the tube and flick with your finger until the bead is dissolved.  Centrifuge a few seconds to send all of the liquid to the bottom of the tube.  Follow your instructor’s direction to load them in the thermal cycler.

PCR Cycles
94 degrees, 2 minutes
25 cycles of
      94 degrees, 30 seconds
      61 degrees, 1 minute
      72 degrees, 1 minute
72 degrees, 4 minutes
end