Possible Bias in Child Paternity

Based on what I have seen in my classes this fall,  I recommend that you always have multiple trios being mated in your lab class (rather than one mating in which you take lots of children).

In the mating of the two fathers to the mother, ideally there would be a 50/50 chance of any given Child being progeny of one or the other.  However, it looks like there tends to be bias in individual matings.  I have taken the extra seeds from the matings the students in my general biology lab did this fall and sprouted them.  Based on color markers, it appears that in any given mating most of the children come from one father, but which father is overrepresented is random.  In other words, sometimes most of the children are from Alleged Father #1 and other times most of the children are from Alleged Father #2.  If there are several matings going on in lab, then overall the students will see both possibilities.   However, if you did one paternity dispute and got lots of children, you probably wouldn’t get very satisfying results.

How is this happening?  I assume that even though the students collect pollen from both fathers on one swab, there is a tendency to get more pollen from one father (but which one appears to be random).  Either one is shedding more at the time of mating or they just spend a little more time on the anthers of one father than the other.

Full Lab Manual Available for Download

The most recent version of the full lab manual and an instructor's reference is now available for download at Doug Wendell's OU faculty web site.  Follow this link
https://files.oakland.edu/users/wendell/web/Teaching_resources.html

Recent paper with details on the markers.

We recently published a paper in Frontiers in Plant Genetics and Genomics where we give molecular details on the markers we've developed.
Here is the link http://www.frontiersin.org/Plant_Genetics_and_Genomics/10.3389/fpls.2012.00118/full

Upcoming Workshop at ABLE 2012 Conference

We will be presenting a workshop our materials and the labs we've developed at ABLE 2012, the annual meeting of the Association for Biology Lab Education, which will be held June 19-22 at UNC Chapel Hill.  For more information, please go to http://www.ableweb.org/conf/able2012/index.htm  Our workshop will demonstrate the projects we've developed for RCBr and share our experiences in implementing them. 
We highly recommend the ABLE conference to anyone interested in improving college biology lab instruction.

Polymorphism in Fast Plant Stocks

If you are using the markers we report here in Wisconsin Fast Plants from Carolina Biological Supply, you will have the greatest degree of polymorphism with the markers D9BrapaS1 and Park14-EcoRI.  More details will be published later.

Single Nucleotide Polymorphisms (SNP) in Rapid Cycling Brassica rapa

Two RCBr SNP detectable by the PCR-RFLP technique

We have developed two markers for RCBr based on SNP.  SNP are generally detected by hybridization with allele-specific probes, or by DNA sequencings.  Neither of these techniques is likely to be practical in a teaching lab.  Therefore, we have identified SNP which happen to reside in a restriction endonuclease site and thus the SNP can be detected as an RFLP.  One allele of the SNP will be cut by the restriction enzyme and one will not.

Par9-HaeIII is a C/G polymorphism on chromosome A09.  It sits in a recognition site for the restriction enzyme HaeIII.  To detect this SNP, amplify RCBr DNA with the following primers

TCCTCAGCTGCTTTAGCCTC

TTGCGACAAAGAAACACAGC

to generate a fragment of about 1000 bp.  Digestion with HaeIII will produce a two fragments of approximately 300 and 700 bp from the G allele but will result in an uncut fragment on the C allele.

Park14-EcoRI is a T/C polymorphism on chromosome A01.  It sits in a recognition site for the restriction enzyme EcoRI.  To detect this SNP, amplify RCBr DNA with the following primers

Forward:  TGTGCTGTAACTGCAAAGCA

Reverse: CGCAAATCACGAGTTCTTCA

to generate a fragment of about 1300 bp.  Digestion with EcoRI will produce either two or three alleles, depending on whether the fragment is of the T or C allele.

To detect these polymorphisms, conduct PCR using the "PCR Protocol for RBr DNA Markers" protocol we posted previously.  After PCR, add 10 Units of the indicated enzyme to 12 ul of PCR reaction and digest for at least one hour at 37 degrees C.  (Both EcoRI and HaeIII are compatible with the conditions of PCR buffer).  Then load into 1.2% agarose gels and run at 150 V for 30 min.

More reliable DNA purification using spin columns

PROCEDURE:  DNA Purification from Plant Tissue Using a Spin Column

Protocol based Qiagen DNeasy Plant DNA purification kit instructions with minor modification

Important notes before starting

• Whenever you obtain some solution from a bottle, use a clean unused pipettor tip.
• If you are purifying more than one sample, be careful not to mix up or cross contaminate them.
• In some steps* of the procedure, you are instructed specific volume and you will see that some liquid is left behind.  This is done because the following step requires a precise volume of sample.  Although this results in a reduced yield of DNA, there will still be plenty of DNA to do all of the tests you need to do.

Procedure:

1. For each tissue sample, obtain the following and label them with the plant’s ID number, printed clearly with an extra fine point Sharpie:

• three 1.5 ml microcentrifuge tubes (label top and side)
• one DNeasy spin column and collection tube (label both parts)

2. Obtain a piece of fresh or frozen leaf tissue of about 50 milligrams.  If a balance is not available, use a leaf or piece of leaf at least one and no more than two square centimeters.

3. Place the leaf tissue in a mortar and pestle.  Add 700 µl of Buffer AP1 and 7 µl RNase A stock and carefully grind the tissue until all is liquefied.
4. Collect 500 µl* of the homogenate and place it in a 1.5 ml microcentrifuge tube labeled with the plant’s ID number.  (If you can’t collect 500 µl, add more Buffer AP1 to bring the volume up to the 500 µl mark on the tube.)  Close the tube and incubate in a 65° C water bath for 10 min.  All of these procedures break down tissue and cell structure and solubilize the molecular components of the cell.
5. Add 165 µl of Buffer AP2 to the lysate and mix.  Place the tube into ice and incubate for 5 min. on ice.  The addition of Buffer AP2 and low temperature cause proteins to precipitate.
6. Centrifuge the lysate for 5 min. at 20,000 x g.  (It’s OK if the centrifuge is at room temp.)  Centrifugation causes the precipitated proteins to form a pellet at the bottom of the tube.  The DNA will remain in solution.
7. Collect 500 µl* of the supernatant and pipette it into a new microcentrifuge tube.  Add 750 µl of Buffer AP3/E.  Close the cap on the tube and invert four times to mix.
8. The next step is to pass the solution through the DNeasy spin column, but the volume of the solution from step 8 is too large to run through at once, so you will pass it through the column it in two parts.  Pipette 650 µl of the mixture from step 8 into the top chamber of a DNeasy spin column (no color) which is seated in the top of a 2 ml collection tube.  Centrifuge for 1 min. at 6,000 x g.  Discard the flow through and add the remainder of the mixture from step 8 the top chamber of the same DNeasy spin column which is seated in the top of a 2 ml collection tube.  Centrifuge for 1 min. at 6,000 x g.  Discard the flow through (but save the collection tube) and save the DNeasy spin column.  As the solution passes through the spin column, the DNA binds to the matrix in the column. 
9. Add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g.  Discard the flow through but save the collection tube.  In the presence of Buffer AW, the DNA remains bound to the spin column, but other materials are washed away.
10. Again, add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g.  Discard the flow through but save the collection tube.  Centrifuge the column and collection tube again for 2 min at 20,000 x g.  This extra spin removes all of the Buffer AW from the spin column so that it won’t interfere with the next step.
11. Remove the DNeasy spin column from its original collection tube and place it in a 1.5 ml microcentrifuge tube that has been labeled on the cap and side with the plant ID number. (The cap of the 1.5 ml microcentrifuge tube will remain flipped open.)  Pipette 50 µl of Buffer AE directly onto the top of the DNeasy membrane.  Look down in to the column to make sure that the buffer lands on and is absorbed by the column, and is not simply clinging to the inside of the tube.  Allow this to stand at room temperature for 5 min.  Buffer AE causes the DNA to elute from the column. The 5 minute wait allows time for the DNA to diffuse off of the column material and into the liquid.
12.  Load the combination of DNeasy spin column and microcentrifuge tube into the rotor of the microcentrifuge with the microcentrifuge tubes’ caps pointing in the counterclockwise direction, and leaving 2 spaces between each tube in the rotor.  (This is done to prevent the microcentrifuge tubes’ caps from breaking off.)  Centrifuge for 1 min. at 6,000 x g.    Save the flow through.  It contains the DNA.    The centrifugation draws the eluate containing the DNA out of the bottom of the spin column.

Discard the DNeasy spin column.  Store the DNA solution in the 1.5 ml microcentrifuge tube in the refrigerator until it is needed.

DNA Markers

Information on DNA Markers

Working stock solution

10 µM primer in 5 mM Tris, pH 7.5

D1BrapaS1

Chromosome: 1

Primer Sequences

D1BrapaS1 F  ACGCTGTGATTTGTTGCTTCCGA

D1BrapaS1 R GGAGGAGCAAGCAGGACCAGGA

Size Range: 500 – 600 bp

Example Gel:

D9BrapaS1

Chromosome: 9

Primer Sequences

D9BrapaS1 F  CCAGCCAAATCGTCACTCATGCGA

D9BrapaS1 R TGCATGCCTAAGAGTTTGGAGTAACAC

Size Range: 400 – 600 bp

Example Gel:

D9BrapaS4

Chromosome: 9

Primer Sequences

D9BrapaS4 F  AGCGATGTAGCACCCGAGTCCA

D9BrapaS4 R TCGAGCTGAGAGGGAAGCTGTGA

Size Range: 300 – 600 bp

Example Gel:

PCR Protocol for RBr DNA Markers

PCR Reactions with PCR Premix

The following is the procedure for starting PCR reactions for the four individuals in your paternity case and one negative control reaction.  The negative control is a reaction with every ingredient except primers.  This procedure uses a liquid premix that contains Taq DNA polymerase, buffer, magnesium chloride, and the nucleotides dATP, dCTP, dGTP, and dTTP.

We have tried several brands of Taq Polymerase and find that Taq from Syzygy Biotech (www.syzygybiotech.com) give excellent results and is very cost effective.

Part I.  deciding how many microliters of DNA sample to use

In each PCR reaction, you should use 40 nanograms of DNA.  For each sample, calculate how many microliters (rounded to the nearest microliter) that you need to obtain 40 ng.

Consult the instructor if the amount needed is more than 4 µl or less than 1µl.

Part II-A.  setting up a single reaction

1.      Use a fine point Sharpie to label a 200 µl PCR tube with the ID # of the plant.

2.      To this tube add the following.:

            12.5  µl Syzygy Taq 2X Master Mix

              2.5  µl Forward Primer stock

              2.5  µl Reverse Primer stock

                x   µl DNA

           7.5–x µl milliQ water*

                  *The  7.5-x ul of water is added to make the total volume of all reactions equal to 25 µl.

3.      Set a micropipettor on 20 ul and with a new clean tip, gently pipette back and forth twice to mix the reaction components.

4.      Follow your instructor’s direction to load them in the thermal cycler.

Part II-B.  negative control

For each group, prepare one negative control as follows:

            12.5  µl Syzygy Taq 2X Master Mix

              8.5  µl milliQ water

              1.0  µl Mother DNA

              1.0  µl Child  DNA

              1.0  µl Possible Father #1 DNA

              1.0  µl Possible Father #2 DNA

Close the cap on the tube and flick with your finger until the bead is dissolved.  Centrifuge a few seconds to send all of the liquid to the bottom of the tube.  Follow your instructor’s direction to load them in the thermal cycler.

PCR Cycles

94 degrees, 2 minutes

25 cycles of

      94 degrees, 30 seconds

      61 degrees, 1 minute

      72 degrees, 1 minute

72 degrees, 4 minutes

end

 

Estimating DNA concentration by staining with Fast Blast DNA Stain

 A simple method to estimate the concentration of DNA in a sample
 

Safety warnings:  This procedure uses methanol which is toxic and flammable.  Glove must be worn whenever handling methanol

Materials Needed

100X BioRad Fast Blast DNA stain

PVDF membrane

DNA concentration standards

distilled water

Procedure

Before beginning the assay, practice spotting 1 µl of water onto piece of used PVDFmembrane.

ALWAYS WEAR CLEAN GLOVES WHEN HANDLING THE PVDF (membrane)

1.  Prepare the membrane.

With a soft lead pencil, draw a series of 1 cm by 1 cm boxes, one for each sample and for each of the three standards.

“Wet” the membrane by dipping it in methanol and leaving it submerged until it is uniformly darkened.

Transfer the membrane to a dish of distilled water and allow it to soak until it no longer repels water

2.  Spot the DNA onto the membrane.

The standards will be provided to you by your instructor.  The samples are the samples of DNA that you purified from the plant tissue.

For each standard or sample to be tested, carefully pipette 1 microliter into the center of the box.  If done properly, it will form a bead at the spot where you pipetted it.  This bead will slowly shrink as the liquid soaks into the membrane.

3.  Allow the membrane to dry for 5 minutes.

4.  Repeat the “wetting” process from step 1.

5.  Place the membrane in a dish with enough 100X Fast Blast DNA stain to cover. Shake for 5 minutes.

6.  Transfer the membrane to a dish of distilled water, and shake until you no longer see blue color washing off the membrane.  You may need to change the water while doing this.

7.  Estimate the concentration of DNA in the sample by comparing the intensity of the blue dot from the sample with the intensity of the blue dots of the standards.  The amount of DNA in the standards are 0 ng/µl, 10 ng/µl, and 100 ng/µl.

Purification of DNA from Brassica rapa Tissue.
Collect Tissue for DNA: http://www.youtube.com/watch?v=UYUmWeIaWpQ

1. Place a piece of leaf tissue of approximately 1 cm2 in a mortar and pestle. Add 600 µl of Lysis Buffer and carefully* grind the tissue until liquefied.
Video: http://www.youtube.com/watch?v=RNFT-VM05V4
* Note: When grinding, be very careful not to introduce froth into the homogenate as this will make it very difficult to collect it for the next step. Grind with smooth motions, bringing the pestle across the entire bottom of the mortar before lifting up. The lysis buffer contains detergent so it is easy for it to get frothy.

2. Collect 600 ul of homogenate and place it in a labeled 1.5 ml microtube. If you don’t recover 600 ul of homogenate, add more Lysis Buffer to the Mortar and pestle, grind briefly, collect liquid and add to the homogenate in the tube until the total recovered volume equals 600 ul.

3. Perform an organic extraction:

• a. In the fume hood, add 600 ul chloroform and close the cap tightly. While holding the cap closed, shake vigorously to form an emulsion.   Video: http://www.youtube.com/watch?v=urmyFrIpp2Q
• b. Incubate at room temperature for 5 minutes. During this incubation, mix periodically to keep the mixture emulsified.
• c. Centrifuge at 12,000 x g for 5 min. at room temperature. After centrifugation, you should see two distinct phases and a layer of solid material between them. The upper liquid phase is the aqueous phase and contains the DNA.
• d. Collect the aqueous (top) phase without disturbing the material at the interface. Try to collect the entire aqueous phase. (The DNA is in the aqueous phase.)   Video: http://www.youtube.com/watch?v=7W3zEnupemk

4. Use your pipettor to estimate the volume of what you recovered in Step 5. To this, add an equal volume of isopropanol at -20 degrees C. Mix by inverting several times.

5. Incubate 5 minutes at room temperature.

6. Place tubes in the centrifuge with the hinge of each tube toward the outside of the rotor and centrifuge at 5,000 x g for 5 min. You should see a small, but visible pellet at the bottom. By placing the hinge of the tube to the outside during centrifugation, you can figure out where to look for the pellet. (Think of how the tube is positioned in the rotor and thus where the pellet should form.

7. Remove and discard the supernatant. (The DNA is in the pellet.)

8. Wash the pellet with 70% ethanol.

• a. Add 500 ul of 70% ethanol to each pellet.
• b. Vortex to dislodge pellet. Don’t worry; the DNA will not redissolve in 70% ethanol.
• c. Centrifuge 5,000 x g for 5 min. Remove supernatant
• d. Centrifuge at 5,000 x g for 20 seconds to get all liquid to the bottom of the tube and remove all liquid with a micropipette.

9. Air dry the pellet by leaving the tube open on the bench top. This usually takes less than 10 minutes. However, the criteria is dryness, not time.

10. Redissolve the DNA that is in the pellet by adding 40 ul of TE buffer.

11. Incubate at 55 degrees for 15 min. During this time, mix every 5 minutes.

12. Centrifuge at 10,000 x g for 5 minutes. Collect all of the supernatant and transfer to a new labeled 0.5 ml microtube. Discard the pellet

Store the DNA in the refrigerator.

About this Blog

Human Genetics with Mustard
Doug Wendell and Dawn Pickard, co-PIs
Oakland University, Rochester, Michigan

The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers.  Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.

As we develop DNA markers and lab procedures we will post the here for all to try.

The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type).  We will be posting protocols and data on the markers  as we develop them.  The intention is that this be interactive so we encourage users to post comments.  Did the materials work?  What steps did your students have problems with?  What parts do you like?  Do you have suggestions for improvement?

Please also check out our YouTube channel:  http://www.youtube.com/user/HumanGeneticsMustard


Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)