The most recent version of the full lab manual and an instructor's reference is now available for download at Doug Wendell's OU faculty web site. Follow this link
https://files.oakland.edu/users/wendell/web/Teaching_resources.html
Human Genetics with Mustard
Doug Wendell and Dawn Pickard, co-PIs
Oakland University, Rochester, Michigan
The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers. Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.
As we develop DNA markers and lab procedures we will post the here for all to try.
The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type). We will be posting protocols and data on the markers as we develop them. The intention is that this be interactive so we encourage users to post comments. Did the materials work? What steps did your students have problems with? What parts do you like? Do you have suggestions for improvement?
Please also check out our YouTube channel: http://www.youtube.com/user/HumanGeneticsMustard
Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)
Oakland University, Rochester, Michigan
The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers. Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.
As we develop DNA markers and lab procedures we will post the here for all to try.
The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type). We will be posting protocols and data on the markers as we develop them. The intention is that this be interactive so we encourage users to post comments. Did the materials work? What steps did your students have problems with? What parts do you like? Do you have suggestions for improvement?
Please also check out our YouTube channel: http://www.youtube.com/user/HumanGeneticsMustard
Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)
Wednesday, September 19, 2012
Sunday, July 22, 2012
Recent paper with details on the markers.
We recently published a paper in Frontiers in Plant Genetics and Genomics where we give molecular details on the markers we've developed.
Here is the link http://www.frontiersin.org/Plant_Genetics_and_Genomics/10.3389/fpls.2012.00118/full
Here is the link http://www.frontiersin.org/Plant_Genetics_and_Genomics/10.3389/fpls.2012.00118/full
Tuesday, March 27, 2012
Upcoming Workshop at ABLE 2012 Conference
We will be presenting a workshop our materials and the labs we've developed at ABLE 2012, the annual meeting of the Association for Biology Lab Education, which will be held June 19-22 at UNC Chapel Hill. For more information, please go to http://www.ableweb.org/conf/able2012/index.htm Our workshop will demonstrate the projects we've developed for RCBr and share our experiences in implementing them.
We highly recommend the ABLE conference to anyone interested in improving college biology lab instruction.
We highly recommend the ABLE conference to anyone interested in improving college biology lab instruction.
Monday, January 9, 2012
Polymorphism in Fast Plant Stocks
If you are using the markers we report here in Wisconsin Fast Plants from Carolina Biological Supply, you will have the greatest degree of polymorphism with the markers D9BrapaS1 and Park14-EcoRI. More details will be published later.
Single Nucleotide Polymorphisms (SNP) in Rapid Cycling Brassica rapa
Two RCBr SNP detectable by the PCR-RFLP technique
We have developed two markers for RCBr based on SNP. SNP are generally detected by hybridization with allele-specific probes, or by DNA sequencings. Neither of these techniques is likely to be practical in a teaching lab. Therefore, we have identified SNP which happen to reside in a restriction endonuclease site and thus the SNP can be detected as an RFLP. One allele of the SNP will be cut by the restriction enzyme and one will not.
Par9-HaeIII is a C/G polymorphism on chromosome A09. It sits in a recognition site for the restriction enzyme HaeIII. To detect this SNP, amplify RCBr DNA with the following primers
TCCTCAGCTGCTTTAGCCTC
TTGCGACAAAGAAACACAGC
to generate a fragment of about 1000 bp. Digestion with HaeIII will produce a two fragments of approximately 300 and 700 bp from the G allele but will result in an uncut fragment on the C allele.
Park14-EcoRI is a T/C polymorphism on chromosome A01. It sits in a recognition site for the restriction enzyme EcoRI. To detect this SNP, amplify RCBr DNA with the following primers
Forward: TGTGCTGTAACTGCAAAGCA
Reverse: CGCAAATCACGAGTTCTTCA
to generate a fragment of about 1300 bp. Digestion with EcoRI will produce either two or three alleles, depending on whether the fragment is of the T or C allele.
To detect these polymorphisms, conduct PCR using the "PCR Protocol for RBr DNA Markers" protocol we posted previously. After PCR, add 10 Units of the indicated enzyme to 12 ul of PCR reaction and digest for at least one hour at 37 degrees C. (Both EcoRI and HaeIII are compatible with the conditions of PCR buffer). Then load into 1.2% agarose gels and run at 150 V for 30 min.
Thursday, November 17, 2011
More reliable DNA purification using spin columns
PROCEDURE: DNA Purification from Plant Tissue Using a Spin Column
Protocol based Qiagen DNeasy Plant DNA purification kit instructions with minor modification
Important notes before starting
- Whenever you obtain some solution from a bottle, use a clean unused pipettor tip.
- If you are purifying more than one sample, be careful not to mix up or cross contaminate them.
- In some steps* of the procedure, you are instructed specific volume and you will see that some liquid is left behind. This is done because the following step requires a precise volume of sample. Although this results in a reduced yield of DNA, there will still be plenty of DNA to do all of the tests you need to do.
Procedure:
- For each tissue sample, obtain the following and label them with the plant’s ID number, printed clearly with an extra fine point Sharpie:
- three 1.5 ml microcentrifuge tubes (label top and side)
- one DNeasy spin column and collection tube (label both parts)
- Obtain a piece of fresh or frozen leaf tissue of about 50 milligrams. If a balance is not available, use a leaf or piece of leaf at least one and no more than two square centimeters.
- Place the leaf tissue in a mortar and pestle. Add 700 µl of Buffer AP1 and 7 µl RNase A stock and carefully grind the tissue until all is liquefied.
- Collect 500 µl* of the homogenate and place it in a 1.5 ml microcentrifuge tube labeled with the plant’s ID number. (If you can’t collect 500 µl, add more Buffer AP1 to bring the volume up to the 500 µl mark on the tube.) Close the tube and incubate in a 65° C water bath for 10 min. All of these procedures break down tissue and cell structure and solubilize the molecular components of the cell.
- Add 165 µl of Buffer AP2 to the lysate and mix. Place the tube into ice and incubate for 5 min. on ice. The addition of Buffer AP2 and low temperature cause proteins to precipitate.
- Centrifuge the lysate for 5 min. at 20,000 x g. (It’s OK if the centrifuge is at room temp.) Centrifugation causes the precipitated proteins to form a pellet at the bottom of the tube. The DNA will remain in solution.
- Collect 500 µl* of the supernatant and pipette it into a new microcentrifuge tube. Add 750 µl of Buffer AP3/E. Close the cap on the tube and invert four times to mix.
- The next step is to pass the solution through the DNeasy spin column, but the volume of the solution from step 8 is too large to run through at once, so you will pass it through the column it in two parts. Pipette 650 µl of the mixture from step 8 into the top chamber of a DNeasy spin column (no color) which is seated in the top of a 2 ml collection tube. Centrifuge for 1 min. at 6,000 x g. Discard the flow through and add the remainder of the mixture from step 8 the top chamber of the same DNeasy spin column which is seated in the top of a 2 ml collection tube. Centrifuge for 1 min. at 6,000 x g. Discard the flow through (but save the collection tube) and save the DNeasy spin column. As the solution passes through the spin column, the DNA binds to the matrix in the column.
- Add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g. Discard the flow through but save the collection tube. In the presence of Buffer AW, the DNA remains bound to the spin column, but other materials are washed away.
- Again, add 500 µl of Buffer AW to the top of the DNeasy spin column and centrifuge 1 min at 6,000 x g. Discard the flow through but save the collection tube. Centrifuge the column and collection tube again for 2 min at 20,000 x g. This extra spin removes all of the Buffer AW from the spin column so that it won’t interfere with the next step.
- Remove the DNeasy spin column from its original collection tube and place it in a 1.5 ml microcentrifuge tube that has been labeled on the cap and side with the plant ID number. (The cap of the 1.5 ml microcentrifuge tube will remain flipped open.) Pipette 50 µl of Buffer AE directly onto the top of the DNeasy membrane. Look down in to the column to make sure that the buffer lands on and is absorbed by the column, and is not simply clinging to the inside of the tube. Allow this to stand at room temperature for 5 min. Buffer AE causes the DNA to elute from the column. The 5 minute wait allows time for the DNA to diffuse off of the column material and into the liquid.
- Load the combination of DNeasy spin column and microcentrifuge tube into the rotor of the microcentrifuge with the microcentrifuge tubes’ caps pointing in the counterclockwise direction, and leaving 2 spaces between each tube in the rotor. (This is done to prevent the microcentrifuge tubes’ caps from breaking off.) Centrifuge for 1 min. at 6,000 x g. Save the flow through. It contains the DNA. The centrifugation draws the eluate containing the DNA out of the bottom of the spin column.
Tuesday, June 21, 2011
DNA Markers
Information on DNA Markers
Working stock solution
10 µM primer in 5 mM Tris, pH 7.5
D1BrapaS1
Chromosome: 1
Primer Sequences
D1BrapaS1 F ACGCTGTGATTTGTTGCTTCCGA
D1BrapaS1 R GGAGGAGCAAGCAGGACCAGGA
Size Range: 500 – 600 bp
D9BrapaS1
Chromosome: 9
Primer Sequences
D9BrapaS1 F CCAGCCAAATCGTCACTCATGCGA
D9BrapaS1 R TGCATGCCTAAGAGTTTGGAGTAACAC
Size Range: 400 – 600 bp
D9BrapaS4
Chromosome: 9
Primer Sequences
D9BrapaS4 F AGCGATGTAGCACCCGAGTCCA
D9BrapaS4 R TCGAGCTGAGAGGGAAGCTGTGA
Size Range: 300 – 600 bp
Subscribe to:
Posts (Atom)
