Possible Bias in Child Paternity

Based on what I have seen in my classes this fall,  I recommend that you always have multiple trios being mated in your lab class (rather than one mating in which you take lots of children).

In the mating of the two fathers to the mother, ideally there would be a 50/50 chance of any given Child being progeny of one or the other.  However, it looks like there tends to be bias in individual matings.  I have taken the extra seeds from the matings the students in my general biology lab did this fall and sprouted them.  Based on color markers, it appears that in any given mating most of the children come from one father, but which father is overrepresented is random.  In other words, sometimes most of the children are from Alleged Father #1 and other times most of the children are from Alleged Father #2.  If there are several matings going on in lab, then overall the students will see both possibilities.   However, if you did one paternity dispute and got lots of children, you probably wouldn’t get very satisfying results.

How is this happening?  I assume that even though the students collect pollen from both fathers on one swab, there is a tendency to get more pollen from one father (but which one appears to be random).  Either one is shedding more at the time of mating or they just spend a little more time on the anthers of one father than the other.

Full Lab Manual Available for Download

The most recent version of the full lab manual and an instructor's reference is now available for download at Doug Wendell's OU faculty web site.  Follow this link
https://files.oakland.edu/users/wendell/web/Teaching_resources.html

Recent paper with details on the markers.

We recently published a paper in Frontiers in Plant Genetics and Genomics where we give molecular details on the markers we've developed.
Here is the link http://www.frontiersin.org/Plant_Genetics_and_Genomics/10.3389/fpls.2012.00118/full

Upcoming Workshop at ABLE 2012 Conference

We will be presenting a workshop our materials and the labs we've developed at ABLE 2012, the annual meeting of the Association for Biology Lab Education, which will be held June 19-22 at UNC Chapel Hill.  For more information, please go to http://www.ableweb.org/conf/able2012/index.htm  Our workshop will demonstrate the projects we've developed for RCBr and share our experiences in implementing them. 
We highly recommend the ABLE conference to anyone interested in improving college biology lab instruction.

Polymorphism in Fast Plant Stocks

If you are using the markers we report here in Wisconsin Fast Plants from Carolina Biological Supply, you will have the greatest degree of polymorphism with the markers D9BrapaS1 and Park14-EcoRI.  More details will be published later.

Single Nucleotide Polymorphisms (SNP) in Rapid Cycling Brassica rapa

Two RCBr SNP detectable by the PCR-RFLP technique

We have developed two markers for RCBr based on SNP.  SNP are generally detected by hybridization with allele-specific probes, or by DNA sequencings.  Neither of these techniques is likely to be practical in a teaching lab.  Therefore, we have identified SNP which happen to reside in a restriction endonuclease site and thus the SNP can be detected as an RFLP.  One allele of the SNP will be cut by the restriction enzyme and one will not.

Par9-HaeIII is a C/G polymorphism on chromosome A09.  It sits in a recognition site for the restriction enzyme HaeIII.  To detect this SNP, amplify RCBr DNA with the following primers

TCCTCAGCTGCTTTAGCCTC

TTGCGACAAAGAAACACAGC

to generate a fragment of about 1000 bp.  Digestion with HaeIII will produce a two fragments of approximately 300 and 700 bp from the G allele but will result in an uncut fragment on the C allele.

Park14-EcoRI is a T/C polymorphism on chromosome A01.  It sits in a recognition site for the restriction enzyme EcoRI.  To detect this SNP, amplify RCBr DNA with the following primers

Forward:  TGTGCTGTAACTGCAAAGCA

Reverse: CGCAAATCACGAGTTCTTCA

to generate a fragment of about 1300 bp.  Digestion with EcoRI will produce either two or three alleles, depending on whether the fragment is of the T or C allele.

To detect these polymorphisms, conduct PCR using the "PCR Protocol for RBr DNA Markers" protocol we posted previously.  After PCR, add 10 Units of the indicated enzyme to 12 ul of PCR reaction and digest for at least one hour at 37 degrees C.  (Both EcoRI and HaeIII are compatible with the conditions of PCR buffer).  Then load into 1.2% agarose gels and run at 150 V for 30 min.