Single Nucleotide Polymorphisms (SNP) in Rapid Cycling Brassica rapa

Two RCBr SNP detectable by the PCR-RFLP technique

We have developed two markers for RCBr based on SNP.  SNP are generally detected by hybridization with allele-specific probes, or by DNA sequencings.  Neither of these techniques is likely to be practical in a teaching lab.  Therefore, we have identified SNP which happen to reside in a restriction endonuclease site and thus the SNP can be detected as an RFLP.  One allele of the SNP will be cut by the restriction enzyme and one will not.

Par9-HaeIII is a C/G polymorphism on chromosome A09.  It sits in a recognition site for the restriction enzyme HaeIII.  To detect this SNP, amplify RCBr DNA with the following primers

TCCTCAGCTGCTTTAGCCTC

TTGCGACAAAGAAACACAGC

to generate a fragment of about 1000 bp.  Digestion with HaeIII will produce a two fragments of approximately 300 and 700 bp from the G allele but will result in an uncut fragment on the C allele.

Park14-EcoRI is a T/C polymorphism on chromosome A01.  It sits in a recognition site for the restriction enzyme EcoRI.  To detect this SNP, amplify RCBr DNA with the following primers

Forward:  TGTGCTGTAACTGCAAAGCA

Reverse: CGCAAATCACGAGTTCTTCA

to generate a fragment of about 1300 bp.  Digestion with EcoRI will produce either two or three alleles, depending on whether the fragment is of the T or C allele.

To detect these polymorphisms, conduct PCR using the "PCR Protocol for RBr DNA Markers" protocol we posted previously.  After PCR, add 10 Units of the indicated enzyme to 12 ul of PCR reaction and digest for at least one hour at 37 degrees C.  (Both EcoRI and HaeIII are compatible with the conditions of PCR buffer).  Then load into 1.2% agarose gels and run at 150 V for 30 min.