HumanGeneticsMustard: January 2012

Human Genetics with Mustard

Doug Wendell and Dawn Pickard, co-PIs
Oakland University, Rochester, Michigan

The goal of our project is to develop DNA markers for rapid-cycling Brassica rapa (aka Wisconsin Fast Plants) and educational materials that use these markers. Our target is college and advanced high school educators who can use our materials to teach key principles of genetics and the scientific process in general.

As we develop DNA markers and lab procedures we will post the here for all to try.

The purpose of this blog is to share information on the procedures and DNA markers that we develop for rapid cycling Brassica rapa (Fast Plants type). We will be posting protocols and data on the markers as we develop them. The intention is that this be interactive so we encourage users to post comments. Did the materials work? What steps did your students have problems with? What parts do you like? Do you have suggestions for improvement?

Please also check out our YouTube channel: http://www.youtube.com/user/HumanGeneticsMustard

Funding
This work was made possible by:
A pilot project grant from the Oakland University Teaching and Learning Committee
Educational Materials Development project grant from the National Science Foundation (grant # 0340910)
An ARRA Award from the National Institutes of Health (grant # 5 RC1 RR030293-02)

Monday, January 9, 2012

Polymorphism in Fast Plant Stocks

If you are using the markers we report here in Wisconsin Fast Plants from Carolina Biological Supply, you will have the greatest degree of polymorphism with the markers D9BrapaS1 and Park14-EcoRI. More details will be published later.

Single Nucleotide Polymorphisms (SNP) in Rapid Cycling Brassica rapa

Two RCBr SNP detectable by the PCR-RFLP technique

We have developed two markers for RCBr based on SNP. SNP are generally detected by hybridization with allele-specific probes, or by DNA sequencings. Neither of these techniques is likely to be practical in a teaching lab. Therefore, we have identified SNP which happen to reside in a restriction endonuclease site and thus the SNP can be detected as an RFLP. One allele of the SNP will be cut by the restriction enzyme and one will not.

Par9-HaeIII is a C/G polymorphism on chromosome A09. It sits in a recognition site for the restriction enzyme HaeIII. To detect this SNP, amplify RCBr DNA with the following primers

TCCTCAGCTGCTTTAGCCTC

TTGCGACAAAGAAACACAGC

to generate a fragment of about 1000 bp. Digestion with HaeIII will produce a two fragments of approximately 300 and 700 bp from the G allele but will result in an uncut fragment on the C allele.

Park14-EcoRI is a T/C polymorphism on chromosome A01. It sits in a recognition site for the restriction enzyme EcoRI. To detect this SNP, amplify RCBr DNA with the following primers

Forward: TGTGCTGTAACTGCAAAGCA

Reverse: CGCAAATCACGAGTTCTTCA

to generate a fragment of about 1300 bp. Digestion with EcoRI will produce either two or three alleles, depending on whether the fragment is of the T or C allele.

To detect these polymorphisms, conduct PCR using the "PCR Protocol for RBr DNA Markers" protocol we posted previously. After PCR, add 10 Units of the indicated enzyme to 12 ul of PCR reaction and digest for at least one hour at 37 degrees C. (Both EcoRI and HaeIII are compatible with the conditions of PCR buffer). Then load into 1.2% agarose gels and run at 150 V for 30 min.